Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0695
Clone ID AC0695
Vector pGT0lxr
Project sanger

Sequence tag AC0695
Sequence
GACTGTCGAGTCGCGTCCACCCGCGAGCACAGCTTCTTTGCAGCTCCTTCGTTGCCGGTCCACACCCGCCACCAG
Sequence Type mRNA
Unitrap ID UNI3488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143668331..143668404 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029580 (Actb) NM_007393 actin, beta Gene [Source:MGI Symbol;Acc:MGI:87904]

 
Come back to gene ENSMUSG00000029580


For any suggestions or comments, please send an email to unitrap@crg.es