Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13095H11
Clone ID IST13095H11
Vector VICTR76
Project tigm

Sequence tag IST13095H11HMF2
Sequence
ACCTTTCNTCTTGGTGAGGTCAATGTGCAGCCGAGTGACAGGACAAGGAAGTAGACATGCAGACAACAGACATGCAGGCG
AACCACCTCCCTTCTGTGTTTGGATAAAAGACACACAACAATTTTTATTATTTACAGTAAGCCTTAAAAAGCACTCTGAC
AGCCACTCAGATATCTACCTTCTATA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74917291..74917475 179
NO GENE  


Sequence tag IST13095H11BBF1
Sequence
CCCCCCTCCCGCCCGGTTTATTTTGGTTCCCGCTCCGGGAGGAAGAGGTCAAGGGGGGGTCATCCCCCTTCGCTTCCGGA
TACTGGGAGGAGCGGAATTGGGAAGGGAGGAGAAGGGTCCCACGGGAGAAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI26978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97525336..97525471 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038437 (Mllt6) NM_139311 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 Gene [Source:MGI (curated);Acc:Mllt6-001]

 
Come back to gene ENSMUSG00000038437


For any suggestions or comments, please send an email to unitrap@crg.es