Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12500F1
Clone ID IST12500F1
Vector VICTR76
Project tigm

Sequence tag IST12500F1BBF1
Sequence
GAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAAC
CCTGTCTCGAAAAACCAAAAAAAAAAAAAAAAAAAAAAAAAAANNCCCC
Sequence Type genomic DNA
Unitrap ID UNI14452 UNI30538 UNI31120 UNI32873 UNI32874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 54050579..54050701 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 70833586..70833708 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060733 (Ipmk) NM_027184 inositol polyphosphate multikinase Gene [Source:MGI (curated);Acc:Ipmk-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61511817..61511939 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042377 (2310040C09Rik) NM_178618 RIKEN cDNA 2310040C09 gene Gene [Source:MGI Symbol;Acc:MGI:1916890]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 106971397..106971519 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041323 (Ak7) adenylate kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1926051]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19156304..19156426 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021774 (Ube2e1) NM_009455 ubiquitin-conjugating enzyme E2E 1, UBC4/5 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107411]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8779644..8779766 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56991648..56991770 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36775009..36775131 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 28965996..28966118 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 108043494..108043616 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 24087607..24087729 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 116015928..116016050 123
 
EST/CDNA Est Name
  AA027451.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27735680..27735802 123
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 9235021..9235143 123
NO GENE  


Sequence tag IST12500F1HMF2
Sequence
GAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAAC
CCTGTCTCGAAAAACCA
Sequence Type genomic DNA
Unitrap ID UNI14452 UNI15140 UNI33426 UNI34232

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4793029..4793125 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6290084..6290180 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19394360..19394456 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17453435..17453531 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 29047117..29047213 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19156330..19156426 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021774 (Ube2e1) NM_009455 ubiquitin-conjugating enzyme E2E 1, UBC4/5 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107411]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39196938..39197034 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8779670..8779766 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 7342000..7342096 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 21077234..21077330 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5280721..5280817 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6645699..6645795 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002107 (Cugbp2) NP_001103702 CUG triplet repeat, RNA binding protein 2 Gene [Source:MGI (curated);Acc:Cugbp2-009]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 38769795..38769891 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 24087607..24087703 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21590166..21590262 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 30017232..30017328 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058440 (Nrf1) NM_010938 nuclear respiratory factor 1 Gene [Source:MGI (curated);Acc:Nrf1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3625491..3625587 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019734 (Tmc4) NM_181820 transmembrane channel-like gene family 4 Gene [Source:MGI (curated);Acc:Tmc4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27735680..27735776 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7988806..7988902 97
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6671302..6671398 97
NO GENE  

 
Come back to gene ENSMUSG00000019734


For any suggestions or comments, please send an email to unitrap@crg.es