Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13270G3
Clone ID IST13270G3
Vector VICTR74
Project tigm

Sequence tag IST13270G3HMF1
Sequence
CTTTTTAATAGCTGAGTAGTACTCCATTGTGTATATGTACCACATTTTCTGTATCCATTCCTCTGTTGAGGGACATCTGG
GTTCTTTCCAGCTTCTGGCTATTATAAATAAGGTTGCTATAAACATAGTGGAGCATGTGTTTGTTCTTATTACCAGTTGG
AATATCTTCTGGATATATGCCCAAAAGAGGTATTGCTGGATCCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 39164996..39165198 203
NO GENE  


Sequence tag IST13270G3BBF1
Sequence
CAACCACATGGTAGCTCACAACCATCTGTAATGAGATCT
Sequence Type genomic DNA
Unitrap ID UNI33212 UNI36642 UNI36702 UNI36703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 95667638..95667676 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18648845..18648883 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55279889..55279927 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17645949..17645987 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18386162..18386200 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009734 (Pou6f2) NP_778171 POU domain, class 6, transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:2443631]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 61742175..61742213 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 99508705..99508743 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23023370..23023408 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060459 (Kng2) NM_201375 kininogen 2 Gene [Source:MGI Symbol;Acc:MGI:3027157]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24679270..24679308 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56764332..56764370 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 48308014..48308052 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18062497..18062535 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68807478..68807516 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40996652..40996690 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 35129478..35129516 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029104 (Hdh) NM_010414 huntingtin Gene [Source:MGI (curated);Acc:Hdh-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 120012563..120012601 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 49738352..49738390 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 65914718..65914756 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30848733..30848771 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165789: 29663..29701 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34672432..34672470 39
NO GENE  

 
Come back to gene ENSMUSG00000029104


For any suggestions or comments, please send an email to unitrap@crg.es