Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10682E11
Clone ID IST10682E11
Vector VICTR76
Project tigm

Sequence tag IST10682E11HMF1
Sequence
AGTCCTGATGTCCTGGAAGCCTGGAAGGATGGGGCGAAATCTCGGAGAAGGAGAGCAGTACTCACCCAGAAGCACAAGAG
TGAGTGAGCCCTGGGGTTTCGGTGCGGTTGGCGGTGACCCAGGAGCACGAGGGATGCGGAGCAGGGCTGAGGTGAGGGTG
GACTCCAGGGCAGGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI12927

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69498062..69498240 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es