Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12818F2
Clone ID IST12818F2
Vector VICTR76
Project tigm

Sequence tag IST12818F2HMR1
Sequence
GGAGATTCAATGCACTTAGGTTTTTTTTGTTTGTTTGTTTGTTTTGTTTTTTATCTCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI36594

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30385453..30385514 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025747 (Tyms) NM_021288 thymidylate synthase Gene [Source:MGI (curated);Acc:Tyms-001]

 
Come back to gene ENSMUSG00000025747


For any suggestions or comments, please send an email to unitrap@crg.es