Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10073F1
Clone ID IST10073F1
Vector VICTR75
Project tigm

Sequence tag IST10073F1BBF3
Sequence
AGTCAAAGGCATGCACTACCATGCCTGGCCCCAAATCCTTTTAAATTACTTACAGGGGGGAAAGTAGAACTTTCTCTTAA
AAGCTACAAGTTTAGTTGTCAGGATATTTATTAACTATAATAAAGATAAGATCACTGATCCTCAATCTATGCCAACCCTT
TTCTGTACACTTGGTTTTTATGGTACTGAGAATCAAATTCTGGGCTTCAAGCTTGCTAAGCAAGAGTTCTACCATTGGAC
CCCTGTATATTTTAAGGAAAGGGGGAAAGAAAGAGAAAATACAGTGAGCCCTAGATTTGACCTCGCCTCAGTTCCCTTAG
GCGCATTCTAAGAAAGCATCCTGTGCACCCACACTGATGGCTCCTCTCACTGCTTTCCCACAGCCACACCCATCTCCCTG
CTGCAGGGCCTGCGGCAGAATTCCCAGACCTACAACAGCAGAGGAGGACCTTAGCTACCTCTTCTCACTACGTGACCTCT
GACAGCATCAGTCCTCCATTTGTTAAATGGAAGGCTACACCTCAGGAAAAGAGTAGGACCAGACTGGTGAACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 101740561..101741113 524
 
EST/CDNA Est Name
  BE913007.1 - BY741492.1 - BF467199.1 - BB645755.1 - BE984582.1 - BB645368.1 - BY727610.1 - BG228484.1 - CJ139759.1 - BF719312.1 - BG069398.2


Sequence tag IST10073F1HMF2
Sequence
CTCCAAGTCCACCCTTTCTATTCCTTAAGATCGTACATAAGGACCCATGCCCTTCAGTATGCAGACATTAGTTGTACTTG
CCTGGACAAATCACTGCCTAAGAATGAAAAGCTAATCAGGACTGGGTACATTAGTTAATTTGAGGAAGAAATAATCTGAA
TATCCTTTCCAGTTTGTCATAGCTCTAGCCTCTAGCTTGATTTGAAAACAAAGAAAAAGCCAGGCGTGGTGGTGCACGCC
TTTAATCCCAGCACTCGGGAGGCAGAGGCAGACGAATTTCTGAGTTCAAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGG
ACAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAAAAACAACAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83252934..83253299 354
 
EST/CDNA Est Name
  BF722469.1 - CN707333.1 - BE284610.1 - AA794484.1 - AA547443.1 - BY360443.1


Sequence tag IST10073F1BBR1
Sequence
GGAGAAGGAATTTCCTGTCTTTATTTCTACTCTCAATGGGAAGAAAGGAAAAAAACCTTCAGAGAACCACTATCTGATCT
TTATGAAAGATGAAAACTCTTGGTTAAAAATGTGCTAACATTTAAAAGAGAGGTAAAGAGGCCAGAGGTACTCTTAAGAC
CAATGTGCTTTCTCATTGGATTGAGTGATTTACTGAGGACTCTGATGCAAACAGTCAAGAGTTCCTTATCTGATAACTTC
ATTATCAGCTAGTTGTATCCAACTGCCTCTGCTTCAGTCCAGATTTCATTAGCTATTTTTAATGATTTTAACCTTACAGA
AACATGTAAGGTTACACATGTATCCTCTAGAAAAGAGTAGATACCCATAGGTTCCTGTTAAACCTCTGAATATCAGATAA
AAGGGGCCAGCCCTGTCTTATATTTCTTGTCCTTAAAATGAGCATTGTTTTGTTGTTATTTTTAGATGTAAAATGGGGTA
AACTGAGAGATTATCAGGTGCGAGGATTGAATTGGCTCATCTCTCTGTATGAGAATGGCATCAATGGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI15463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83252386..83252937 552
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031715 (Smarca5) NM_053124 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 Gene [Source:MGI (curated);Acc:Smarca5-001]

 
Come back to gene ENSMUSG00000031715


For any suggestions or comments, please send an email to unitrap@crg.es