Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14182G6
Clone ID IST14182G6
Vector VICTR74
Project tigm

Sequence tag IST14182G6HMF2
Sequence
TTGGTAGATACTGGCTACAGCTCCAGGTCCAAGTCTCCTAACTGAAGGAGGAGGAGCAGCAGGGGAGCTGGCAACGACCC
CGCAGGCCCCTCCCGAACCCTCCCCCAAGCCCGCACACTGTCCAGCCACCTGCTCCCCCGCCCACAAGGGCGGGACAGCC
ACCCCAGTTCCNATGGCAACACGCGCCCCGGTGGGCCCCAGCATCCCTGCTACAGCGCAGTCNATCTGGCCCCCAGCCCA
CCCCAGCTGGGCGACCCTANGCGTGCTCTCCGGGGGATCCGGCTGCTCTCTGGGGGTCACTGTANCCCCGCGGCGACCAG
AGCCCAGANCAAGANCTCCNNTGCCCGCACCTCCCGGTACCATGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106528399..106528763 345
NO GENE  


Sequence tag IST14182G6HMR1
Sequence
ACTGTGCCCAATNTTNATGGGCNANATAGGGGACATTTCCAGGGCCTTGTGTATGCTAGGCAGTTAGATAACTTTACCAA
CTGGGCTACCCTCCCCCCACCCTCTGCCCTAGTGTGTGTGCTTTGTANCCCAGGTTANCCTGGCGCACTGGGTCCTCCTT
CCTTANTCTCCCGANCACAGGGATGACAGGAGTGCACCTTGCTTTTCAACTCCTGCTTTATCTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI23167

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117849866..117850098 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017715 (Pgs1) NM_133757 phosphatidylglycerophosphate synthase 1 Gene [Source:MGI (curated);Acc:Pgs1-001]

 
Come back to gene ENSMUSG00000017715


For any suggestions or comments, please send an email to unitrap@crg.es