Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14140G7
Clone ID IST14140G7
Vector VICTR74
Project tigm

Sequence tag IST14140G7HMF1
Sequence
CAGAAAAAGAGGCTAACAAGAAAATCCTTTACTAATACTANAGTTAAAATGTCTTCTATTATGTATAATAAATACCAATT
CATTTAANAGTGAAAAATCAAACTACAAACCAACTCATTTATCTCCCATACGAATGTTTCAGTTTTTTCAAAGTCTGTTA
AAATTTAAGTATGCNCNTTCTTAACTGGTAAGTGACATTAAACTTTTTGAACCNCCCTTTGANTCCNACAACAAAGTAAA
TATGANNNNAGANAACTAAACCNAAAGAAAAAAANGANAAAGAAAAGCCAGANGTGGTGGCGCACGCCATTAACCCCAGC
ACTCANGANGCAGANACAGGCGGATTTTTGAGTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14140G7HMR1
Sequence
TCTGCAGTTGGATTAACATTAAAATCATTGTTTTCCAGGTTCTTTAAAACATACTTAAAATAATATCTGTACTTTACTTT
TTAGTAAGTTTATTTTATAACTAAGTGTATCTAACCTACTTCAGTTTGTTTTCTTTTAAAGATTTATTATACATAAGTAC
ACTATAGCTGATTTCAGACACACCAGAAGAGAGCATCANATCCTATTACNGATGGTTGTGAGCCACCATGTGGTTGCTGG
GATNTGAACTCAGGACCTTCAGAAGAGCAGTCAGTGCTCTTACTCNCTGANCCNTCTTGCCAGCCCCCCCCCNNTTNAA
Sequence Type genomic DNA
Unitrap ID UNI15835

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32781696..32782007 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013662 (Atad1) NM_026487 ATPase family, AAA domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915229]

 
Come back to gene ENSMUSG00000013662


For any suggestions or comments, please send an email to unitrap@crg.es