Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14913B1
Clone ID IST14913B1
Vector VICTR76
Project tigm

Sequence tag IST14913B1HMF1
Sequence
GAACTATATCTCAAACAAGGTAGATTCTGTACATAAGCTAGGCAAGCAATAAAATGCAATCTTCTAAAAATATCCTAGAG
CTCTGAACAAACTAAATATTAAATACAAGAGAAATGTCAAAAGGAAGAACATCAATTAAAATAACCATAATTTTTCATTC
CTGATTAAGTCATCAATTTTCATTACAAAGCAATTTCTTTATTGCCCTTTCCAAAGTGATCATAAGTTACATAAAAGGCA
GATCTCTGTGAATTCAAGGCCAGCCTGGTTCACATCATGAGTTCCAGTATAGCCAGGGCTACTTAAGGTCCCTGTCTCAA
AAAACAAACCNACACCCAACACTCTTCCGCCCTTTTCTATCAGACAGGCTCCTTTANGCCCTTGTCATTAGCTCACACCA
CCNNNNCCCTTTAACATATCCCTTACTTTGTCATAAATCACTTTTATAATGAGTGAGCNNCTNGGACACGTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32897667..32898139 455
 
EST/CDNA Est Name
  BC039954.1 - AK011448.1 - NM_172254.3 - BC029910.1


Sequence tag IST14913B1HMR1
Sequence
GNANCCNNTANGAATGGCAATAGAAAAGGGGTAAATATCTTTACTTCCCACCCAAAGCTCAGTTAGTGCTTTGGAGTCTA
AGTACAGAATGTAACAGTCTAGAGGATAAATTCTAAAATGACTATAGGGTAAGTTGGACCAAAGCACAGAACTTTGTGGG
AGAAGCAGGTGTTAATTTAGACAATAATANAAATGTAATGATTCATTCTTATTTTAAAATGGTTTATGGAGCAAAGAACA
ATGGACAGACTANGGACTGACTCCTTGGGAATCACACTGTAGAGGATGTGTAGTAACTGGGAAAGTTTTTGTGGTANCTG
GCANANNCCNNCNTGAAANATCNNAGTGTGAACTTCNTTTANAG
Sequence Type genomic DNA
Unitrap ID UNI29128

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32897274..32897626 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021905 (Dph3) NM_001047433 DPH3 homolog (KTI11, S. cerevisiae) Gene [Source:MGI (curated);Acc:Dph3-001]

 
Come back to gene ENSMUSG00000021905


For any suggestions or comments, please send an email to unitrap@crg.es