Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14947G3
Clone ID IST14947G3
Vector VICTR76
Project tigm

Sequence tag IST14947G3HMF1
Sequence
GCATCAAGGATAACCCCCCCCCCCCAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66650817..66650851 33
NO GENE  


Sequence tag IST14947G3HMR1
Sequence
TGCTTTGGCCTGAAGTGTTTGGACAANAAACAGAAAATGTCCAAAGATTGAAAGTCCTTTTGAGAAGGAGCCAGTGTTCT
CTCATTTACCAATGCTAAACAAGTANAANTATAATATGAAAATTTTTCATTGTAGAAATACGCTAACTTGATAGCTATCA
TGTTC
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66650849..66651012 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es