Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10455E10
Clone ID IST10455E10
Vector VICTR76
Project tigm

Sequence tag IST10455E10HMR1
Sequence
ATTTTCATAAATGACAATATATGTATAGTTTGCACTTTTTAAGTATTTGACTAAATATTAAGCCCGTCAGTTGGAGTCTA
GGAAGCATTTTC
Sequence Type genomic DNA
Unitrap ID UNI16126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116752944..116753034 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031024 (St5) NM_001001326 suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]

 
Come back to gene ENSMUSG00000031024


For any suggestions or comments, please send an email to unitrap@crg.es