Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12375B2
Clone ID IST12375B2
Vector VICTR76
Project tigm

Sequence tag IST12375B2HMF1
Sequence
CCATCTTCGTGGGGAAGGAAGCTGCTTTCTTTCTTTTTCCTAGGGCCGTCCGGCCGCCACCACTCTGCCCAGGTCTCCAA
CTAGGGGAGCGGAGAATTTTCACCAACGGAGCCGAACGCTGACGACTACCGGGAACAAGCGAAACCGGCACGCTCATCCT
CCCGCATTAGTTCCCAGTAGGGAACTATTTTCCGGTACACTCTAGGCGGTCCAACTCTTTTCAGAAGAGCTTCCGGTTTC
CACCCACCTACTTCCGCTGTCCCCACCTCTTTTCTTCCGCCACCCGGATATGAGCCGTTCTCGCGAGAGCCGTCCCTCTT
TCTAAGCCGGCGATCCGTCAGGTAGGTTCGCGGGCCGNANTGTGGCCGCGGTTTTTCNNANANTN
Sequence Type genomic DNA
Unitrap ID UNI29525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 29320685..29321061 373
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061477 (Rps7) NM_011300 ribosomal protein S7 Gene [Source:MGI Symbol;Acc:MGI:1333818]

 
Come back to gene ENSMUSG00000061477


For any suggestions or comments, please send an email to unitrap@crg.es