Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15109H2
Clone ID IST15109H2
Vector VICTR80
Project tigm

Sequence tag IST15109H2HMF1
Sequence
NCTTGTTNNTTANAANNGCNTNNNANNNNGTCNAAAANTACACNCNCATCCTTGANTATTANNTAATGTANAANGNNNNC
NCTATCNCACCANTANTGNACNNGGANAANNNANTGCCTTCTTTACNNTTCTAAANATGTGGCTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15109H2BBF1
Sequence
ACAGCTGACAGCACTTCCTTCCATGGTAAATCCATATCATCACTTCTAATATTATTCTTTTCCAGAATCATTAAGGAAAT
AGAATCTGGGAAAATCAAATTCATGTCCTCTTTCTACTCACAGGTGAGCCCAACTCCACCCATTGTTCAATACCTCTAAC
ATACCTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147014857..147015027 171
 
EST/CDNA Est Name
  CN679893.1 - CD549057.1 - CF164649.1 - CJ086722.1 - CF164501.1 - CF166675.1 - CF164823.1


Sequence tag IST15109H2HMR1
Sequence
ANNCANANANAACANGAATTGTCCTTTCNACTTGGTTCTGCTTTGCAGGATTCTTAAAAACTGACACTTTGAAAATGATT
GTATGTTAAGTCTTAAATTTACCCAGGACACCATCTGGTAGTGAAGGGCCTACAGTTAAAGGCAGGATTTTGTAGGAGGG
ATTAGAGTGGCAAATTAATATTATTTTCATGTATAGAGTTTAAGAGAGTAACTTTGGGAATAAAGTCACAGTGAGCTGTG
TAGTGTTGTGTGGGTCCTTGATACCAGTAATTCAAGAGGGTGAGGTAGAATTTTAGGTAGAGGCCATCTTGGCCTGTAAA
GTGAGACTCTACTTCAAGCAGTAAGCCTGAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30064422..30064771 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es