Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST429389
Clone ID OST429389
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST429389
Sequence
TGGCGGTTTGGATCTACACCCTCCCACATCTCCAAACGGCCAGTGTTCTTGTTTGAGGAGCCCCCCTAATCCTACCCAAC
TGGAAACCACACATACCAGGAGATTGCGGTGCCACCTNCGGTCCCACCACCACCGTCCAGCGAGGCCCTCAATGGCACGG
TCCTGGACCCTTTAGATCAGTGGTAGCCTAGTGGTTCCAGATACGCTCACCANCAGCCTCCGTCCCCANTGCCCGTGTAC
AGCTCCAGTGCTAAA
Sequence Type mRNA
Unitrap ID UNI18140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115994369..115994928 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029528 (Pxn) NM_011223 paxillin Gene [Source:MGI (curated);Acc:Pxn-001]

 
Come back to gene ENSMUSG00000029528


For any suggestions or comments, please send an email to unitrap@crg.es