Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14601A12
Clone ID IST14601A12
Vector VICTR74
Project tigm

Sequence tag IST14601A12HMF1
Sequence
GGCCTAGTTGGATCCCAGTCATCCCGCCTCTTGATTTTTTTAAGGAAGGAGGCCAGGAGGGGGACAGGGAANCATGGCAT
CCAGCTGTGATATCAGAAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122821576..122821676 99
NO GENE  


Sequence tag IST14601A12HMR1
Sequence
GCCCACAATCATGGCTCTTGTAGAATCTGAATCCGT
Sequence Type genomic DNA
Unitrap ID UNI34243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122821543..122821578 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029463 (1500011H22Rik) NM_026883 RIKEN cDNA 1500011H22 gene Gene [Source:MGI Symbol;Acc:MGI:1916198]

 
Come back to gene ENSMUSG00000029463


For any suggestions or comments, please send an email to unitrap@crg.es