Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11629E4
Clone ID IST11629E4
Vector VICTR76
Project tigm

Sequence tag IST11629E4HMR1
Sequence
AATAAACTGCTGCCGTCCAGCTGCAAGGTCTCAACTTGTTTTTGGATGCAACCTAC
Sequence Type genomic DNA
Unitrap ID UNI10489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110019031..110019086 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032480 (Dhx30) NM_133347 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Gene [Source:MGI Symbol;Acc:MGI:1920081]

 
Come back to gene ENSMUSG00000032480


For any suggestions or comments, please send an email to unitrap@crg.es