Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14255B3
Clone ID IST14255B3
Vector VICTR74
Project tigm

Sequence tag IST14255B3HMR1
Sequence
GCTATGTTTGGGAAGTCCAACCTACTCAAATGTGTGATCTCTTTTGTTTCTGTTTGCTTTCTTTCCCCTCCTGGCTCCTC
TGACCGAGGCACCCGGTTGCCAGTCCCTGGATCTCTTTGCCTCTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165706370..165706497 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es