Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12536A4
Clone ID IST12536A4
Vector VICTR76
Project tigm

Sequence tag IST12536A4HMF1
Sequence
CTCACATCGATTAGTTTTGCCCTCCCTTACTGTCCATTGTTATATTACTATTTTGTAGCACTGAGGATGAAATACAAGGT
CTCTCACATGCTAGGCAAGTAACTATTCTGCCACTGAGCTGCACCCATAAGCCACCATCAACCATTTTTAAACTTTANAT
AAATAAAACCAATTTCTATTTTTAGTGCCACCTTTTCCTCAAGATCATCTTGTGAGATTTGAGTGCATGGCGTGTAGTGA
TATTTTCCCTCATTTTCATGACTGTGCAAAATTCCAGTATATTACTATAACAGATTATTTATCCCTTCTACTGTTGAAAG
ACTCCTAGGTTGTTGGGTTGTTTCTTGGTTTTTGCTGTTATANGTAATGTTGAATANTTTCCCNAAAGTAATTGANTCNC
TTTGCATCNNCANTGTATGTGATTTCTGGTTCTTCCGCCTGCCTGCN
Sequence Type genomic DNA
Unitrap ID UNI10441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4704524..4704968 424
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]


Sequence tag IST12536A4BBF1
Sequence
CTCACATCGATTAGTTTTGCCCTCCCTTACTGTCCATTGTTATATTACTATTTTGTAGCACTGAGGATGAAATACAAGGT
CTCTCACATGCTAGGCAAGTAACTATTCTGCCACTGAGCTGCACCCATAAGCCACCATCAACCATTTTTAAACTTTAGAT
AAATAAAACCAATTTCTATTTTTAGTGCCACCTTTTCCTCAAGATCATCTTGTGAGATTTGAGTGCATGGCGTGTAGTGA
TATTTTCCCTCATTTTCATGACTGTGCAGAATTCCAGTATATTACTATAACAGATTATTTATCCCTTCTACTGTTGAAAG
ACTCCTAGGTTGTTGGGTTGTTTCTTGGTTTTTGCTGTTATAGGTAATGTTGAATAGTTTCCCNAAGTAATTGAATCNCT
TTGCATCNNCANTGTATGTGATTTCNGGTTCTTCCNCCTGCCTGCCNACACTTGGCATTCTCTCN
Sequence Type genomic DNA
Unitrap ID UNI10441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4704505..4704968 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es