Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14942B5
Clone ID IST14942B5
Vector VICTR76
Project tigm

Sequence tag IST14942B5HMR1
Sequence
TCATGGAGCTACTCCATTCCCGCAATGAGGGCACCGGTGAGGGACCCATGACTTGGTGTGGGGTGCAGGGGAGCACCAGA
GGGAGGAGGCTGGGCTCTGTTCCTCCAGCTGCAGCACTGACAGCCTCTGACTTGGTCTTAACTTCCCTCCCTCTCTGCCC
AGCGACCTACGCTGCTGCTGTCCTGTTCCGCATCTCTGAGGACAAGAACCCANNTTACCGTAAGCGAGTGTCTGTGGAGC
TCACCAATTCCCTCTTCANGCATGACCCAGCTGCCTGGGAGGCTGTGAGTATCANACCNCATCTGACTGTGCN
Sequence Type genomic DNA
Unitrap ID UNI2261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100235364..100235675 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es