Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14207F2
Clone ID IST14207F2
Vector VICTR74
Project tigm

Sequence tag IST14207F2HMF1
Sequence
NAGGGAGGTTTATTAGTAGTAAATATATTTCACTGCACATGTATGAAACTCTCAAGAATACAAATCTTTAAAAAGCTATG
CTAGTTAGTCTTTTGTCAATCTGATACTAGAGTTATATAGGAAGAGAGAACCTTTATGGGAAAACGCCTTCAACAGCTTG
CCCTCTGGGCATGTCTGGGCAAGTAGAGGCATTTTCTTGATAATGACTGATGTGGGAGGGTCTAGCCCATGGTGGGTGGT
GCCNCCCCTGAGCAGATGGTTTTGGGTTGTTTAGAAAAGCAAAATCANTANCCTATGGACNGTANNCNNTGTNAACAGTG
TTCCNTGGCCTCTGCTTGANTTCACNCNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97004053..97004396 322
 
EST/CDNA Est Name
  BB858590.1 - CJ065342.1 - BY018951.1 - BY766629.1 - BY013506.1 - BY173463.1 - BY303870.1 - BY009822.1 - BY016748.1 - BY143963.1 - BY032315.1 - BY060654.1 - BY015665.1 - BY015241.1 - BY013639.1 - BY017077.1 - BY162410.1 - BY019147.1


Sequence tag IST14207F2BBF1
Sequence
GAGGGAGGTTTATTANTAGTAAATATATTTNACTGCACATGTATGAAACTCTCAANAATACAAATCTTTAAAAAGCTATG
CTAGTTANTCTTTTGTCAATCTGATACTANAGTTATATAGGAAGAGAGAACCTTTATGGGAAAACGCCTTCAACAGCTTG
CCCTCTGGGCATGTCTGGGCAAGTANAGGCNTTTTCTTGATAATGACTGATGTGGGAGGGTCNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97004052..97004273 208
NO GENE  


Sequence tag IST14207F2HMR1
Sequence
CCTCCAACACCCCCATATTCCTCTCAGTACAGTCCCCTAATTTCATGCATGCACACACACACCCCATCTAGTTGGGGCTA
CCTTTCTGTGCNTGGGTGTTGGACCATCCACTGGAGTGTGGAAATTGTTCCAGTAGCCACAGCACTCAAATTTTAAATGT
AATTTTCCTTACTCTAGCAGCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI10738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 97003871..97004055 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032449 (Slc25a36) NM_138756 solute carrier family 25, member 36 Gene [Source:MGI (curated);Acc:Slc25a36-001]

 
Come back to gene ENSMUSG00000032449


For any suggestions or comments, please send an email to unitrap@crg.es