Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15028B6
Clone ID IST15028B6
Vector VICTR78
Project tigm

Sequence tag IST15028B6HMF1
Sequence
CTTAAATATGTCACCCAAGGATTGCACATGTTTATCTAATACAGATCCTGAAATGGGAATTCATTACTAACTGGTTCTAG
CTAACCTGCCCAAATTAAACACCCACGAATCAGATTTTACTAAACTATATCCATAAATTAATATAATCTGTGAAGTTATC
AAATTATTCTCACTGCCCTAATCAGGTCCTTCTCCATAACAGTGACCCCTGCAGCATACTCCCCTCTGGTCTGTGACCTA
GCTCTTGTCAGCACTGTTTTATCTGACAGTGTACACAGTAAGCTGTTTCTCTGGTTCTCATCCTGCCAAGTGTATTTCCA
CACACAAACCCCTGCCACAAAGGTTTTGTCCAAATGCAGGCTTATAATAAAGTTACTCANANGCCACANCCNGGTCCANA
AGGANAGACTANNTCNNCNNGGGACCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175546568..175546994 401
NO GENE  


Sequence tag IST15028B6HMR1
Sequence
AANTGAGCTCAAAAATGTAAAACACATGCCATTACTTGTAACTGTGTGTGTCACATTATAGGTCTCAGTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI15567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175546992..175547064 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078893 (BX890623.7-202) Novel KRAB box and zinc finger, C2H2 type domain containing protein [Source:UniProtKB/TrEMBL;Acc:A2ARL5]

 
Come back to gene ENSMUSG00000078893


For any suggestions or comments, please send an email to unitrap@crg.es