Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14522E4
Clone ID IST14522E4
Vector VICTR74
Project tigm

Sequence tag IST14522E4HMF1
Sequence
TTGACAAATTAGCTCCACTAGTAGAAGCCAAGAACTTTGCCTTTTGTTTCTTTCTACTAGTTTTAAGAGTTTATCTTCAA
TAGAAGCATCTTAGGAAAAGGGAAATAGGAGTATTTTCAAAGGNNNNNGAACCCAACAAGTGCTACACAGTGCTTTAGCT
TACCAAGAAACTACCTGTAAACAACAGCCTGTTTCTCGCATCACTGACAAAGACACCCTGNTATAGCAGGCTTCTTTCTG
AATGCTNACCATGGGGGAGCTAAAAACTTGAGAAAATGGACTTAATGTATTGATGCCTTGCCAGCACAACATACTATCTT
TCAGATTTTTATGTTTGGATCCCAACTCCTGGAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168021748..168022103 342
 
EST/CDNA Est Name
  BE984217.1 - AI448578.1 - BF467007.1 - AI847388.1 - BF318191.1 - BE852757.1 - AW049256.1 - BF464091.1


Sequence tag IST14522E4BBF1
Sequence
TTGACAAATTAGCTCCACTAGTAGAAGCCAAGAACTTTGCCTTTTGTTTCTTTCTACTAGTTTTAAGAGTTTATCTTCAA
TAGAAGCATCTTAGGAAAAGGGAAATAGGAGTATTTTCAAAGGGAACAGAACCCAACAAGTGCTACACAGTGCTTTAGCT
TACCAAGAAACTACCTGTAAACAACAGCCTGTTTCTCGCATCACTGACAAAGACACCCTGATATAGCAGGCTTCTTTCTG
AATGCTCACCATGGGGGAGCTAAAAACTTGAGAAAATGGACTTAATGTATTGATGCCTTGCCNGCACAACATACTATCTT
TCAGATTTTTATGTTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168021748..168022088 339
 
EST/CDNA Est Name
  BE984217.1 - AI448578.1 - AI847388.1 - BF318191.1 - BE852757.1 - AW049256.1 - BF464091.1


Sequence tag IST14522E4HMR1
Sequence
GGTTCATTCCAACAGTTTTCGTANTGAGATTAAAAGAGAAACCAGAATCCCAGCACAGAGGGAGCTGAGGCAGGAGGTCC
GAGTTTGAAGCCNGCCTGCATTGGATAATCTGC
Sequence Type genomic DNA
Unitrap ID UNI13540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74022544..74022655 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034845 (Plvap) NM_032398 plasmalemma vesicle associated protein Gene [Source:MGI Symbol;Acc:MGI:1890497]

 
Come back to gene ENSMUSG00000034845


For any suggestions or comments, please send an email to unitrap@crg.es