Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13072A12
Clone ID IST13072A12
Vector VICTR76
Project tigm

Sequence tag IST13072A12BBF1
Sequence
ATANNNNNNNGNGNNNANNANNGNTTNNNANCNNNNCTGANTNNNACNNNNNNNNAAATAACANCNANATCCCTCANNGA
NANCAACCCTCTCCAGTATCTGTTTTATAAGGTTCCGAGTCGGTCACCAAGGTTCTTGCANAACAAGGAAAGATATTTGA
GGCCCGGGGTTCTGTCTCANCANNCCACAGTCCTTCACCTATCCTTANCCCTTGGTGTTAAGGTCNCGGTTATCAAGCAC
GGGAGTCATANACTGCTCCAGAGTGGCGGTGTGTGTATTCTGTGCTCATCTCCCGCAGTGAGCTGAACTTCCAGCAGCCT
GTGAGTGACTCAGGCTCATGCCTAAGGACACACTCTGGGACAGANGTCCTTAATCTCAAATTCATTGACCTTGGCTGAGA
AAATCTTACATCCTTGTTTTAGAGAACACTTCCNGTTATGGTTTGGAGAGACNGCTCATCGGTCAAGANTACACACACTG
TACCNGGCNATGNTGTTGGCATAANCNCTTAATTCCNGCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13072A12HMF2
Sequence
GCAGTAAGCTTTTAATCTCAAAAACTTCTCCACGTCTGTAATGTTTTCACTGTAGAATTATTTCTCAACTAGGACAACTC
CTTATCAACCAAGAGTTATCTAGTTCAAGAGTTATCTAGTTCAAGATAGTAGTGCCAAAGGTGAGGAATCTGTAGTAGAA
AGTTGGCGCTGTGAAGGTCATGTGTTCCTTGGTGTGGGTTTGAGTGAAGAGAAACTGTGGGGGGGGTGCGGTAGGGGGGA
AGCACCTGCTATATTCTAAAGGAATCTCTTCCAGTANATGTGCATGGGATGGGACTGTANCATAGGAGAGAACGTGCTAT
TTAAAGCCNTGGTACCATTAATACTACAATGGATTACCCACATCCAGGTCTGGACTTCCTTANGAACAGGACCCTGCCCT
GACTTTCCCAAGCCAGGCTTCTATACCTGTAAGCNNACCTGTTACAAGCNAGAAGANGAAAACTGTGGTTGCTGAACTGC
TTCTAGATTTGAATATTCATAGTGATTTATNANATCCNNTN
Sequence Type genomic DNA
Unitrap ID UNI2514

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25589380..25589896 497
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es