Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10601D3
Clone ID IST10601D3
Vector VICTR76
Project tigm

Sequence tag IST10601D3BBF1
Sequence
NNNNTCAGTGGGTAAGAGCACCTGACTGCTCTTCCGAAGGTCCNGAGTTCAAATCCCANCAACCACATGGTGGCTCACAA
CCATCTGTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI36214 UNI36717 UNI36718 UNI36719

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 158140876..158140970 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 42494666..42494760 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019802 (Sec63) NM_153055 SEC63-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Sec63-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54842467..54842561 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069227 (Gprin1) NM_012014 G protein-regulated inducer of neurite outgrowth 1 Gene [Source:MGI Symbol;Acc:MGI:1349455]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 92291063..92291157 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32305228..32305322 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 107442298..107442392 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 34734787..34734881 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038836 (Agbl3) NM_178630 ATP/GTP binding protein-like 3 Gene [Source:MGI (curated);Acc:Agbl3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3202905..3202999 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57061426..57061520 91
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103282803..103282897 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033792 (Atp7a) NM_009726 ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI (curated);Acc:Atp7a-002]

 
Come back to gene ENSMUSG00000033792


For any suggestions or comments, please send an email to unitrap@crg.es