Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14524C10
Clone ID IST14524C10
Vector VICTR74
Project tigm

Sequence tag IST14524C10HMF1
Sequence
ACACTGCCTACCGTCTTCACGTCAGCACGGGTGTGGCAAACTGAAAAGCCATCACAGTCTGATAGTTCTCAACAGACACT
GAGAATATATCCTGTCCAGTTCTTATACAGAATGAATGCTTGGACAATAAAAGCAGAAAGTCATTAATCAGCCCCAAAAC
ACAGAGCCAAAGAAAGTGACTTTCTCTACTAAAAGTTTAAATTAGGCCAAGTAGTAGTGGTGCACGCCTTTGACCCCCAA
CACTGGGAAGGCAGAGGCAGGTGGCTTTCTTTCCATTTAAGGCNNGCCTGATCTACAGAGTGAGTTCCAGAACAGCCAGG
ACTACATAGAGAAACTCTGTCTCAGAAAATAAAAAACAAAAGTTTTCATTAAAATGTTGATTCATCAAAAATCACTTGTA
AAACACCCTCANGAGCCTTACACTGCCGTGGTGATGGTGACAATGGCAGCNAAGCATCTGGATCANTTTCANTAAGCCGT
ACGTAAATCTCCATAGGTACNGAGCTAATAAAATAATGATTTCTNNCTGNANTAAAAAANNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107714348..107714886 517
 
EST/CDNA Est Name
  CD349172.1 - CF534300.1 - CD349114.1 - CK635986.1 - CN538851.1 - CF741392.1 - CV555938.1 - CN536148.1 - CN538899.1 - CV559179.1 - CF741401.1 - BQ770536.1 - CA329120.1 - CV555723.1 - CD348830.1 - BU055589.1 - CF726346.1 - CN535110.1 - CN538371.1 - CN537757


Sequence tag IST14524C10HMR1
Sequence
AGTGTCTCCTCACCCCCGTCTCAGTGCATTGACTTGGACTCGCTCTGCATCAGCATCAACATCAGGNACACCGTCCGTGT
TCAGGATTTTTNAGTTTTTTTTCTTTTATTAGTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI7597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107714232..107714352 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042590 (AC165281.2) NM_029665 Importin-11 (Imp11)(Ran-binding protein 11)(RanBP11) [Source:UniProtKB/Swiss-Prot;Acc:Q8K2V6]

 
Come back to gene ENSMUSG00000042590


For any suggestions or comments, please send an email to unitrap@crg.es