Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12242D2
Clone ID IST12242D2
Vector VICTR76
Project tigm

Sequence tag IST12242D2BBF1
Sequence
TACCAACCAAAGAATACACATGGAGCGACCTATGGCACAGGCCACATATGTGGCAGAAGATGGCCTTGTTGGACATCAGT
GGTAGAAGAGGTCCTCGGGCTTGAGGGTGCCCCAGTATAGGGCGGGAGGATAGGAGTATGTGGGTGGGGGAGGACCGTCA
TAGAGGCAGGGGGGAGGGGAGATGGGATGGGGGTTTCCAAAGCAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI10326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104310491..104310702 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032913 (Lrig2) NM_001025067 leucine-rich repeats and immunoglobulin-like domains 2 Gene [Source:MGI Symbol;Acc:MGI:2443718]

 
Come back to gene ENSMUSG00000032913


For any suggestions or comments, please send an email to unitrap@crg.es