Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST428934
Clone ID OST428934
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST428934
Sequence
GAAGTCAATATGGAGATGCAGCCAAGCATTTTGTTCTACTCCTAAGGGTGTGACTTATAGGGAACTAAAAAGCCTACTGA
ACTCCAAAGACATTATGTTAATTGATGTTAGAAATACATGGGAAATTCTTGAGCAAGGAAAAATACCTGGATCAATCAAC
ATACCATTGGATGAGGTAGGTGAAGCTCTGCAGATGAACCCAGTGGACTTCAAAGAGAAGTACTGTCAAGTGAAGCCATC
CAAATCTGACCGTCTGGTGTTCTCTTGTTTAGCTGGAGTGAGAAGTAAGAAGGCTATGGACACAGCAATATCACTGGGCT
TTAACAGTGCTCAACATTATGCTGGAGGATGGAAGGAATGGGTAACCTATGAAATTTCAGAGGAGAAACAAGAAAGTTGA
CTTTTGGAATTACAGACTCGGTGTTCATATCTATAAGGATGGTGGATTAAGCAAAAGAAAAACCCAGCCCTGGCACCAAA
GGCTAATAGATTCTGGATGACTGCTGCTT
Sequence Type mRNA
Unitrap ID UNI18155

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21685445..21686936 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028251 (2610029I01Rik) RIKEN cDNA 2610029I01 gene Gene [Source:MGI Symbol;Acc:MGI:1924282]

 
Come back to gene ENSMUSG00000028251


For any suggestions or comments, please send an email to unitrap@crg.es