Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14276B9
Clone ID IST14276B9
Vector VICTR74
Project tigm

Sequence tag IST14276B9HMF1
Sequence
NNTNNNATGTTCTGATTATTACAAAAAGACTATTACATGCAACTAGGGAGGGGCCTCCCCACACCACTCCCCCTTCTTTT
CTAATTACATGAAAATGTAAAAAGGGGGCCCATGAGATGGCTATCAATACAAAGGATTACTTTTTTTANAAAAAGCTATA
TATTATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72660796..72660958 161
NO GENE  


Sequence tag IST14276B9BBF1
Sequence
NTGTTCTGATTATTACAAAAAGACTATTACNTGCNACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14276B9HMR1
Sequence
CATTAAAGCATGGTCTACGAATGTGAATGCATTACATTTCAGTACATCAAAATTTCACCTACTTGAGTGCTAAGTCTTCC
TTATATAAACACTGATTAAAATATTTTAGGAATACCAAGTAACCAGAGAGCTGTATTGATGTTCCTTGCGTCCTTAATGC
GGGCGTAAGATAAATCTCAGAGGAAAGCGTTAGTGCGCTAAAACAGTCTCATATTTCAACAAGTGTAAATTAANATAAGG
GAAGTAAAGGAGGAGGCGGGTGTGTTCTGTGATGTGTAAAANTCNGGCCNNCT
Sequence Type genomic DNA
Unitrap ID UNI17261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72660956..72661244 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036030 (Prtg) NM_175485 protogenin homolog (Gallus gallus) Gene [Source:MGI Symbol;Acc:MGI:2444710]

 
Come back to gene ENSMUSG00000036030


For any suggestions or comments, please send an email to unitrap@crg.es