Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10756G11
Clone ID IST10756G11
Vector VICTR76
Project tigm

Sequence tag IST10756G11BBF1
Sequence
GTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACNANATCTGT
Sequence Type genomic DNA
Unitrap ID UNI12672 UNI31785

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20308862..20308915 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26417983..26418036 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18030966..18031019 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 139062412..139062465 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047940 (B930007M17Rik) NM_198659 RIKEN cDNA B930007M17 gene Gene [Source:MGI Symbol;Acc:MGI:2685863]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 55580664..55580717 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34849562..34849615 50
NO GENE  


Sequence tag IST10756G11HMR1
Sequence
NNGAAACTATTAAGGACACACAGTGGCCTCTTCACTGCTGTCTTCCAGGCTCCCTGTCCTGCCTTTTCACTACAACCCTC
TCTTCAGTTAAAACATCTTTGAAAAACTCTTCCTGAACTTAGTGGTGTACCCCTTTGATCCCAGCACATGGGAGCATTCN
AAGCCAGCTTGGTTTACATAGTGAATTCCAGGGTCAGCATCCAGAAGTGAGGAGGTCACTCACTTCATGGGGACCATGAC
TTGAAAGTACCATCTCTTTGCTGAACCCTTTTCTCTGGGCNCCTCTGGNATTCTTGTCCAATTTANAAAAAAGCTGTGGT
GTTNTGGGAATGTN
Sequence Type genomic DNA
Unitrap ID UNI4257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79736283..79736613 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009585 (Apobec3) NM_030255 apolipoprotein B mRNA editing enzyme, catalytic polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:1933111]

 
Come back to gene ENSMUSG00000009585


For any suggestions or comments, please send an email to unitrap@crg.es