Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11260A9
Clone ID IST11260A9
Vector VICTR76
Project tigm

Sequence tag IST11260A9HMF1
Sequence
GCTACCTTTTCCAGTTAAACAGTAATCAAACTGGCTCTGATGATACACATCTATATTCCCAGCACATGGGTATACAAAGA
GGAACATGAGTTGAGAACAGACAGTAATAAAAACTAGTTCAGAGCTGGAGAGATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126549617..126549752 136
NO GENE  


Sequence tag IST11260A9HMR1
Sequence
GTAGCTAGCAGATTTTAACTACACTGACACACGCATACACACAGACACTTGTAATTTTCTGGAGGGAGATCAAAGATCAA
AATGGGCAGGAATTATCTCAAGAATTTGTGACTAAAATCAAAAAAGTCTGTATTTCTCTGTCAAAATAGTATTTCCGGAT
ACCATGATAATAGGTATTACCATTAAAATCCAGTACTAATGAGCATTTANTACTCATGACAGGCTCAAAGGGCATAAGGA
TATAGCTGTTCATCACATGAATAGTAAGTGGCAGTGTTGGGATTTGAACCTAGATGTGCCTAGTGACTAAGCTGTTCAGC
CNNANCNNNTANNANNNNNNNNNANCNNANNNNGGANCAAAGAANCANCTNAGGTGCCNNTAATTCTTAANACCACACCC
TTTATTGTGANACTTTAAAAANAANNNTTNTTATTCN
Sequence Type genomic DNA
Unitrap ID UNI36723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126549748..126550183 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031976 (AK122209) NM_001029876 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2681124]

 
Come back to gene ENSMUSG00000031976


For any suggestions or comments, please send an email to unitrap@crg.es