Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12391C9
Clone ID IST12391C9
Vector VICTR76
Project tigm

Sequence tag IST12391C9HMF1
Sequence
TGCTCGTAGTGAGAAAACCCAGGATGGCTGGGCTGCTGGGCACAGTTGCCAGCTCTGGGGTTTCCTGGCCGGAGTGGAAC
CAGCCTCCTTGCTGTCCCTCTGGGCTAAACTTGAAATGATGTTCCTAGGCTCATTCTAACTANAGGACATCATGTGACAT
TGTCCTAGATCAGGCCCATATTTANGGACCTCCCACAAATGCACCAACTCGTTGCCCATAGGGGTTGGTCTANTTTNNAG
ANNANGGTACCA
Sequence Type genomic DNA
Unitrap ID UNI31218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31228302..31228552 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029162 (Khk) NM_008439 ketohexokinase Gene [Source:MGI (curated);Acc:Khk-002]


Sequence tag IST12391C9BBF1
Sequence
TGCTCGTAGTGAGAAAACCCAGGATGGCTGGGCTGCTGGGCACAGTTGCCAGCTCTGGGGTTTCCTGGCCGGAGTGGAAC
CAGCCTCCTTGCTGTCCCTCTGGGCTAAACTTGAAATGATGTTCCTAGGCTCATTCTAACTAGAGGACATCATGTGACAT
TGTCCTAGATCAGGCCCATATTTAGGGACCTCCCACAAATGCACCAACTCGTTGCCCATAGGGGTTGGTCTAGTTTTTAG
AAGATGGTACCCAACAGGTCCCCTAAGGTGATATTACTTCCTGGCTAGAGAGGTACCATGGCAAGATTGGAAGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31228302..31228619 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029162 (Khk) NM_008439 ketohexokinase Gene [Source:MGI (curated);Acc:Khk-002]

 
Come back to gene ENSMUSG00000029162


For any suggestions or comments, please send an email to unitrap@crg.es