Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12258G11
Clone ID IST12258G11
Vector VICTR76
Project tigm

Sequence tag IST12258G11BBF1
Sequence
CGCCAATGTGACATCCGANTTGTCGTTGCTCTGTAATTGGGTTAANNTTTTTGGTATGGTCAGACTTTTAATNNNCTATC
CGCCATGAGTAAATCCAAACNNNNTCTTAGGGTTATAAAACAGGTTTCTCTGTTGGCAGGATTGGCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12258G11HMF1
Sequence
CGCCAATGTGACATCCGAGTTGTCGTTGCTCTGTAATTGGGTTAATTTTTTTGGTATGGTCAGACTTTTAATTTTCTATC
CGCCATGAGTAAATCCAAACGTTTTCTTAGGGTTATAAAACAGGTTTCTCTGTTGGCAGGATTGGCGGATCCAGGTTGTG
CGCTAGCCGGACGCAGGCGTAGACCTCCAAGAGCAACGACGAGTGCAGGCTAGAGGAGCCTAGGGGGGCGGGGCGAGGGA
GGCGGAAGTGGACCGGTCCCGGCGGCCATTTTGCCGTGAGACAGCAGGAGTTAGGCGCGATGCTTTCCACTGCTGCTTAC
CGAGACGTGGAACGAGAGCTGGGAATGGGGCCTCACGGCTCCGCCGGCCCTGTGCAGCTGCGGTTTTCGCCTTATGCCTT
CNACGGANGGTAAAAGCCTGGGCCTGCTGCCCTCACCTGGGTCGAGCCTGGGGTCGCGACGGGCGGGTGTGGGAATGGCN
NGGATGTAN
Sequence Type genomic DNA
Unitrap ID UNI19714

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15635038..15635525 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014769 (Psmb1) NM_011185 proteasome (prosome, macropain) subunit, beta type 1 Gene [Source:MGI Symbol;Acc:MGI:104884]

 
Come back to gene ENSMUSG00000014769


For any suggestions or comments, please send an email to unitrap@crg.es