Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13566F10
Clone ID IST13566F10
Vector VICTR74
Project tigm

Sequence tag IST13566F10BBF1
Sequence
NATAGGTCTGAATATTCTTGCCCAAGGGAACTGGCACTATTAAAANGTGTGGCCTTATTGGAGGANGCNTANCCTTGTTA
NAGGAAGGGTGACATTGTANANACNNGGCTTTGAAATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13566F10HMR1
Sequence
TGTTCTGCCNTGTGGCTCATCAGTTATCTTGGTTCATTCCTCCATGTCTGGCTGGTGAATCCTCCTATGTCAGAGGCTTT
CCCAGAGTTCCTGTCTCTGCCCAGAAGTCCTGCCTATTCTCTCCTCCTTTGCTATAGGCGATTAACCTTTCATTAAACCA
ATCAAAAGGTGAGGGAGGGAGGGAGAGTTTACAAACTATGATGTAGCCATCTGAATAACAGTACCAAGCCATCTGCACTC
AACTCTCTGCCAGCTCAGAAATCAGCATTTAAAGAATACAAAGACAGCCTTTACACAGTGCACAAAAAACCACCCCAACA
GATTGCAGTAGCTTTAACTGTGACTCAAAACAAAGCCCCTTGTCCTTGAGTTGCTTTTCTCAGGGTGTTTTTATCACAGC
CATAGTTNAAATAGACAGTGTTAGAGATGGGGTGGTGNNANAACNNAGCANCN
Sequence Type genomic DNA
Unitrap ID UNI33340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30729218..30729667 436
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es