Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11751H8
Clone ID IST11751H8
Vector VICTR76
Project tigm

Sequence tag IST11751H8HMF1
Sequence
CCATATATTTGTGTATATATGTTTCTATATATGTACATGTGTTCTAGGCACCTGAAGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27173123..27173182 60
 
EST/CDNA Est Name
  DV071379.1 - DV070897.1


Sequence tag IST11751H8BBF1
Sequence
CTCTAATCCCAGCACTTGGGAGACAGAAGCAGGCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17244213..17244252 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es