Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11020C7
Clone ID IST11020C7
Vector VICTR76
Project tigm

Sequence tag IST11020C7HMF1
Sequence
CTGTGAACTANGAGGCCCTGNNGAGCCTAACAGCTGTGCTGGAGTGTANAGTTAGGAAGTTAGGTATGGGCATGAGTGCT
ATTANAGAAAGCAGGACGCTGGGAGAGGAAGTTAGGCTTGACAGGTGGGCTCTGGGCCTAATGGTGTTAANAACTGACCT
GGAGAATGAGGGAGGGGTCTGCGTGCACAGAAGGGCACAGGGAACAGAGAACTCAAGCTGCTACCTTAAGCAGGACCTGC
TTACTGCTGTGTATACTTCANANTCCCAGCGTGGCGGGAAGGTTCAAGACAGACCACAAAAGGCCTTTGTANCCNTCCTG
AANTGTCTAGGCTCCGCTCTTTTGGCGGTTGGGAGTCACTGAAGGTTCTAGACCTGGCTCTGTAGCTATAACAGCCCCTT
TCCCCAGCCTGGAAATTGCCCATCACAGTGGAGCANAGTGGCTTCTGTANCTACCTTGTCTGCAANCTANCAAGANNNGG
TGGNNCACCTCTGGGCAGGTGCTGACNANTTNAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11020C7BBF1
Sequence
CTGTGAACTAGGAGGCCCTGCAGGAGCCTAACAGCTGTGCTGGAGTGTAGAGTTAGGAAGTTAGGTATGGGCATGAGTGC
TATTAGAGAAAGCAGGACGCTGGGAGAGGAAGTTAGGCTTGACAGGTGGGCTCTGGGCCTAATGGTGTTAAGAACTGACC
TGGAGAATGAGGGAGGGGTCTGCGTGCACAGAAGGGCACAGGGAACAGAGAACTCAAGCTGCTACCTTAAGCAGGACCTG
CTTACTGCTGTGTATACTTCANNNTCCCAGCGTGGCGGGAAGGTTCAAGACAGACCACAAAAGGCCTTTGTAGCCNTCCT
GAAATGTCTAGGCTCCGCTCTTTTGGCGGTTGGGAGTCACTGAAGGTTCTAGACCTGGCTCTGTAGCTATAACAGCCCCT
TTCCCCAGCCTGGAAATTGCCCATCACAGTGGANCAGANTGGCTTCTGTAGCTACCTTGTCTGCAAGCTAGCAAGAACNN
GTGGAGCACCTCTGGGCN

Sequence Type genomic DNA
Unitrap ID UNI32007

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58152123..58152619 481
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032334 (Loxl1) NP_034859 lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]

 
Come back to gene ENSMUSG00000032334


For any suggestions or comments, please send an email to unitrap@crg.es