Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10016G10
Clone ID IST10016G10
Vector VICTR75
Project tigm

Sequence tag IST10016G10HMF2
Sequence
AAATCCTCCCATCTCCGCCTGAAGAGAGCTGGGATTAAAGACATGCGCCATCACTCCCGGCTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10016G10BBF1
Sequence
AAGTGAAAGGAATCAAGTTTCAGAGAAGGCAATTGGCTTGCTCAATATTTCACAGCAAATTTTGAGCGTTTTTTTTTCCG
Sequence Type genomic DNA
Unitrap ID UNI11597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164649145..164649224 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017764 (Zswim1) NM_028028 zinc finger, SWIM domain containing 1 Gene [Source:MGI (curated);Acc:Zswim1-001]

 
Come back to gene ENSMUSG00000017764


For any suggestions or comments, please send an email to unitrap@crg.es