Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12494G12
Clone ID IST12494G12
Vector VICTR76
Project tigm

Sequence tag IST12494G12HMF1
Sequence
GTGGCACAGACTTTTAGTCAAAGCATTTGGGAGGCAGAAGCAGGAGGATTTCTGAGTTCAAGGTCAGAGTGAGTTCCAGA
ATAGCTAGGACTACACGCAGAAACTCTGTCTTGGAAAAACCCAACCAACCAATCAACCAACCAACCANACAAACAAACNA
AGAGTANCTGTAAGGGTCCATGATTCGCTGAAGAATGATACCCTAGACTCAAATTGTATGTAAACAGAAAGAGTGTTCTA
TTCTGCAAGAGTCCAGCATGCTGGGATCTCCCCATTACCANNATANACNACCNANGGAGCTTAAAGGCTAGATTTNNNGC
ACACTAANNATTCCGGNGTANGCGACCNNNAANNTTCTTTATCNCNGANANCNNNNTATTANGANANCANGGAGTTGCTG
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12494G12BBF1
Sequence
TGGGAACCGAAGCAATGGGAGCATTTGAAGCGATGGAGAGATGCGTTCGTTCCAGAACCTGGTTGACTCTTTGGCTGAAC
ACTCCAAGGGTCTGGGAGGCGCCATTGTACAAAACGGCCACAACGCGCGGGTACTTTCATCCCTGGAACTTCCTGCCTGC
ACCCCCAGGAAGTCTAAAAACTAACTTTCCGGTGTACAAAGATTGACTCCCTGTCTGGGCTTAGACGAGACGCAGAGCAC
TGCACTTGACTTCTTTCCCCCACTTCAGGCGGGGTAGGAGACTCCCAGGAACCGCACTGCAGAAGCGACCTCTGGGCCTC
ACCCTGCAGGTTCATCCCTGGCCCAGGGCCAGGCACTAAGTTAGTAGACGCTGGCGTGGGTATCAGAAGCACTTAGGGTC
CTGTGGTCTCANAAGTGTGGCCTTCCCTCCTGTTGTCTCTCCTGTTGANTTGTGGTTTCCTAACNAATCTGTGAATGTTC
CTTTTCAGANCACANGAGCNAGCTTTACAGACNCTTAAAATAGCACNTGTGGAATGGAATAATCCCAAAANTCCCGATN
Sequence Type genomic DNA
Unitrap ID UNI31461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91227759..91228316 540
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039830 (Olig2) NM_016967 oligodendrocyte transcription factor 2 Gene [Source:MGI (curated);Acc:Olig2-001]

 
Come back to gene ENSMUSG00000039830


For any suggestions or comments, please send an email to unitrap@crg.es