Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11631G1
Clone ID IST11631G1
Vector VICTR76
Project tigm

Sequence tag IST11631G1HMF1
Sequence
NGATCTGACACCCCCTGGAGAGCCCTCTGGGGCGCACAGGTGCGCCGGCTTCNACTGTCCCTGCCCCTCCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86264885..86264956 70
NO GENE  


Sequence tag IST11631G1HMR1
Sequence
ATCCTAATGGGCTTGAGTGTTGCCAGTTTGGANACTAAGAGGGAGAAACTGAGGCACGGGGGCAGTTAAAGAGGGTAACA
AAGCAGGCATGGTGTCACAGGGCATTAGGGAGGCTGAGGCAGCAGGGTCACCAATTTCAGGTCAGCTTGTGCTACACAGC
AAGACCCTGTCTNAAAAGAACAAAAGAAAAAGAAATGCANGCTANAGGCTGGGGTGGTGCCGAGGTCAANAGCATTAANA
GAGGACCTGGCTGGGTCCCANCACCTATC
Sequence Type genomic DNA
Unitrap ID UNI6526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86264620..86264887 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002885 (Cd97) NM_011925 CD97 antigen Gene [Source:MGI (curated);Acc:Cd97-001]

 
Come back to gene ENSMUSG00000002885


For any suggestions or comments, please send an email to unitrap@crg.es