Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14639C1
Clone ID IST14639C1
Vector VICTR74
Project tigm

Sequence tag IST14639C1BBF1
Sequence
CCACGGCAGGTTCCATGTGTGTAGGCCTACATGCGAGGATGCTGTACACACGTGTATATACAGTACACGCATGTGGAGGC
CAGGAGGACATGAGATTTCCTATTCAATCACTTTTGCTTCTAAGACAGTGTCTCTCACTAAATCTGCTGCTAGGCTGGTG
GTCAGCAAGCCCCCAGTGACCTTCTTGTCGACTAACCCTAACCCTGTACAACCATGTTTGGCTTTCTACATGGGCTCCGA
GGGCATGACCTCGGGTCCTTATGTTCGTATGGCAAGTGCTCTCAACCACTGGGATATCTCCCTAGTCCAGGCTGGAGTTN
AGTGTTCTACTAACGAGGANAAAGACTANGGACCCGGCTAGTTNCNCGCATCTGAAAGCNATGGAACACACTCTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30985911..30986306 384
 
EST/CDNA Est Name
  CD550220.1 - BE288421.1 - BY241837.1 - BY237845.1 - BB850099.1 - CJ186961.1 - BY237301.1 - BY289585.1 - BY297428.1 - BY215370.1 - BY130346.1 - BY216838.1 - BY233334.1 - BY209407.1 - BY015615.1 - BY268166.1 - BY127928.1 - BY338249.1 - BY343807.1 - BY220999


Sequence tag IST14639C1HMF1
Sequence
CCACGGCAGGTTCCATGTGTGTAGGCCTACATGCGAGGATGCTGTACACACGTGTATATACAGTACACGCATGTGGAGGC
CAGGAGGACATGAGATTTCCTATTCAATCACTTTTGCTTCTAAGACAGTGTCTCTCACTAAATCTGCTGCTAGGCTGGTG
GTCAGCAAGCCCCCAGTGACCTTCTTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30985911..30986099 189
 
EST/CDNA Est Name
  BI133911.1 - BQ900760.1


Sequence tag IST14639C1HMR1
Sequence
GTGGCTTCTTCTTCCCTGTCTTCTCCACTCCTGTACTGCTCACACAACCTTGGCAGGGTTATCAGCCTCTGCTCCCAGCT
CTTTCAACCTAACAGCTTGCCTGGAGGTGACTCTTACTGACCAAATCCCCAAGACTGACGGATAACACAGAATGCAAACT
GAAACTTCACGAGGGGTANAGGTGCCANTCTGTACACTCCTTCCCCANAGGCCGATCTGTGTGGGAAACTNNATTCTGTA
TTGAGTTTCCTGGAGAGCAGAAAGTCCANACNGGATCTGATGAGTTGAATANCTGTGACAGCNAGCTGTGGGCGCCTGAN
NCTCCTCTGGCCTGGNNANNNCNGNNCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI29473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30985580..30985914 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es