Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11324F5
Clone ID IST11324F5
Vector VICTR76
Project tigm

Sequence tag IST11324F5HMF2
Sequence
CCAGGNCAGCCAGGGCTACACAGANAAACCCTGTCTCAAAACAAACAAACAAACCCNAAAACAAATGCNTTTGTTATTTT
AAAAAAAAGTCATATGTTTTGAAAGGTGTTCAAAATATAAAACTCATAAAAGGGGGGGAGTTTTTGACGATTACAGAAGG
GGCATAGTGATGACAGATTGCTGAGAAGCGGGGATCTGCGCGTGGCTGGAGCGATTTCCANCACAGCCTGCTCTTANCCT
NAGGGCTAAATCTGANCACATTTGNNNATATTTTGGACCTGAAAGGAGGTTGGGCATGAAAATAACCNCTGTGTCTAACC
NAGCTTTTGAAACCNCAGGCTGATGGGAAGACGCTGCCTGGTCAAGTGTTCCGGATGCANNCNTGTGTCATCTGTTTTCC
CGACACCCTTCTNACTTGCTANATAANGGGGCAAACTTATTTTCCATGTTGCANANANANGNNNTGANGTATAGGGAGTC
TGGGANANTNNTTACNCNNNATCGCAGTGAGTCANAGNNTTTTTNAGTACCACAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11324F5BBF1
Sequence
CCAGGACAGCCAGGGCTACACAGANAAACCCTGTCTCAAAAC
Sequence Type genomic DNA
Unitrap ID UNI12836 UNI24295

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4893773..4893814 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 13735553..13735594 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4786915..4786956 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034285 (Nipsnap1) NM_008698 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans) Gene [Source:MGI (curated);Acc:Nipsnap1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 25593665..25593706 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 21248750..21248791 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 20656597..20656638 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 11750295..11750336 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8646552..8646593 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3186446..3186487 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5253668..5253709 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 9018307..9018348 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 14233520..14233561 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 6219537..6219578 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11042035..11042076 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6063146..6063187 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7387065..7387106 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3486468..3486509 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 7741977..7742018 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7457044..7457085 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7588274..7588315 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es