Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14531A9
Clone ID IST14531A9
Vector VICTR74
Project tigm

Sequence tag IST14531A9HMF1
Sequence
AGCTCTGAACTCTTCCCTTACTAATACATCTTAAATGTAAGTTAAGGCATGGAGCGTGTGCAGTGTTCACTGCCCACAGG
GAGATTCTTCTCTGAAGGTTTCTAAGGGGCTTCCTGTGTCTAATCAGTTTGTTGTGGTTTGCATTTGGGGCACCCCACAG
AGGCTCCTGTACAGGGCTTGCTCCCCTATTGAAGCAGTAGGCCTTCGGGGGAATGATAGTATTGTGAGAGTTCCAGTCTC
ACAAACAGATTAACCCATTGTTGGGTTCACTGTTGAATGAGCTATTGCTATTGGGAGGTGGTAGAAAGAGTGGAGAGTGG
AATGGGATTGGAGGATCATTTCCNGACAGACACCCCTATCTTGGTCNCCTTCCTCTACATCCAAGCACCNNAAAGTTNTG
CCTTANNTCANNTGAAAATGGAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 25563789..25564211 405
NO GENE  


Sequence tag IST14531A9HMR1
Sequence
CTTTCTTTTGGTGATAACAGACCCCGTCTCTCCCCAGGACAAGGACGGTCTTCTTGANACCTCTCAGAACACTGAAAAGG
AGACGCGTCC
Sequence Type genomic DNA
Unitrap ID UNI518

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114652229..114652317 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]

 
Come back to gene ENSMUSG00000042348


For any suggestions or comments, please send an email to unitrap@crg.es