Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST428401
Clone ID OST428401
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST428401
Sequence
GACTGAGGGGACGATTCATCTCTTTCGAAGCCCAGCAGTATCTTTTTTTGGAAAGTTACTACAGGAATTTAGACTTGTAG
CAGCTGACCGGAGGTCCTGGAAGATCCTTCTGTTCGGTGCAATCAACGTGCTGTGCACTGGCTTCCTGCTCATGTGGTGC
AGCTCCACCAACAGCATCGCATTAACNTGCCTATACTTACCTCACCATCTTTGATCTCTTTAGGTAAGTTCTTTTAAATA
TCCTTTAAANTCTAAAGACACTAAGCAAAGATTTCTTGTCCTGAATCTATTAAGCTTCCTTTACTTAAAGGAAAGNAATT
ATTGAAATTAGTAAATTTATCCTATAAAAGCCTTTAANCCCANAGGTCAGGAGTCA
Sequence Type mRNA
Unitrap ID UNI4673

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74801250..74805220 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024069 (Slc30a6) NM_144798 solute carrier family 30 (zinc transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:2386741]

 
Come back to gene ENSMUSG00000024069


For any suggestions or comments, please send an email to unitrap@crg.es