Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14557B3
Clone ID IST14557B3
Vector VICTR74
Project tigm

Sequence tag IST14557B3HMF3
Sequence
TATTCATCCTAGCCAGAAACTGGAAACAACCAAGAGGTACCTCAACTGTAGAATGGATAAACAAGAAGTGTGGTCCATTT
ATACAATGAAGTATCACTCAGCTGTTTAAAACAAACAAAAACCGACATCATGAATTTACAGCCAAGTGAATGCAACTTAA
AGAAACAAACAAAATACTTTGGAATCAGCTTTCCTGTTAGGAGTTTTCTTTAGATTGTTTTGAATTTATGGTGCAAATTA
AACCTACCCAACATCCCTTTTATTTTTTTAAAACCTCCCTATAATGGTGTTTTTTTACAGTTGTAAGTATGTGAAACTGA
AAATGACGTGAAATAATGTACAAAGCTATAGAAAGAGGACTTTANCATAGACTTTANGGACACAGANTACATTGTTAGGG
TTACATAAATGATATCTCACTAANTATAACTTANTTGANAAAACAAAAAGAGTGAAAANNANANATTGTCCAGAATTGAA
TAATGAATNNGANTGTGATACNNGGTTNTNTNTTAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121811901..121812415 479
NO GENE  


Sequence tag IST14557B3BBF2
Sequence
TATTNATCCTAGCCAGAAACTGGAAACAACCAAGAGGTACCTCAACTGTAGAATGGATAAACAAGAAGTGTGGTCCATTT
ATACAATGAAGTATCACTCAGCTGTTTAAAACAAACAAAAACCGACATCATGAATTTACAGCCAAGTGAATGCAACTTAA
AGAAACAAACAAAATACTTTGGAATCAGCTTTCCTGTTAGGAGTTTTCTTTANATTGTTTTGAATTTATGGTGCAAATTA
AACCTACCCAACATCCCTTTTATTTTTTTAAAACCTCCCTATAATGGTGTTTTTTTACAGTTGTAAGTATGTGAAACTGA
AAATGACGTGAAATAATGTACAAAGCTATAGAAAGAGGACTTTANCATAGACTTTAGGGACNCNNAGTACATTGTTAGGG
TTACATAAATGANATCTCACTAAGTATAACTTAATTGANAAAACAAANAGAGTGAAAATNAGACNTTGTCCANANTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121811901..121812378 452
NO GENE  


Sequence tag IST14557B3HMR1
Sequence
ATAAATATGCTATGAACCTANTTGAGCAAATGTCCCTGAGGTAGGGAGGAGCACCTTTTGGATAGATTCCCAAGAGCAGT
ATAGCTGAGTTTTGGGTAGATGGATTCTCAGTGTTCTGAGGAACCACAATTCTGAGGAAATACTGATTTCTATAGTGATG
GTATTAGTTTGTACCCCACAAGGAGCTGGGGGTTTGTTTCCCTTTCTCCACATTCTTGCNNNCATGAGCTGTCACTTGTA
TTATTGATCTCAACCCTTCTGACATGTACNANANANNTGCTCAAAGTAATTTTGATTTGCATTCCCCTCATGGCTAAGAT
GGCNATGATTTCATTAGGTATTTCTCAGCTTTNNGAGACTCCTCTGTTGAGAATTCTCTGTTTACATCTATNCCNCATTA
TAATTGGAACTTTTTGCTTTGGATAGTCNANTTTCTTGANGTTGTTATATATTNNGNAN
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121811451..121811903 419
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es