Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14190C7
Clone ID IST14190C7
Vector VICTR74
Project tigm

Sequence tag IST14190C7BBF1
Sequence
CAGACTTGATGCTAGAGTCTGTTGTGCCAGGGAAATATTAGTGATCCCAAAAAAGACAGACAGGAGTTGATCTGATGTAA
CTCACAGCAGGGTCTTTATTCTATTTGAGCAAGCTCCCCTGCCCCCAACACATCACCTTCAAGCAAGACAGTTATAGTGG
TGGGGAAGCCTCAACTGTCTATGTGGCAAGGCTTTACAGTAAGCAACAAGCAGGGNTTCATGTGCAAGCACCTAATTANA
AAGCTGCTGTGCCCTTTAACATAATTGGCTGGTTCTGGGANTCCTATCATAAACTTANCTTCNGCTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53703116..53703423 298
NO GENE  


Sequence tag IST14190C7HMF2
Sequence
AAAAGAAAAAAACTTCAACTTTCTATTGTGTGAACATGGCAAACCATATTATCAAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101308680..101308738 59
NO GENE  


Sequence tag IST14190C7HMR1
Sequence
CTTTTCTGTTCTCTATGCTTCNNAATTCACTCACACCTAAGTTCAACCTCCTTGAAATAAAGAATACTTGTATATATTTA
CATGTGTANAAATATAATTCATGTTTTTCTAANACAATGTCTTACTGTATAGTTGTGACTGTCCTGGAACTCACTACTGT
TTGAAACTCACTTTGTAGACCAGGCTGACCTCAAACTCACAGANATCCACCTGCCTCTGCCTCTTAAGTGCTGGGATTAA
TANTGTGCACCGCTTTTGTCTAAANCAATTTATAAAAAATAAATATAGAATTTGGAGTTCTTTTTAAAGAATATCAACTT
TTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30077

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101308359..101308684 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046449 (C77370) NP_001070822 Uncharacterized protein KIAA2022 [Source:UniProtKB/Swiss-Prot;Acc:Q5DTT1]

 
Come back to gene ENSMUSG00000046449


For any suggestions or comments, please send an email to unitrap@crg.es