Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10403H8
Clone ID IST10403H8
Vector VICTR76
Project tigm

Sequence tag IST10403H8HMF1
Sequence
GTATGTTTGTCTGTGTTTGTCACTCTATCTTTTACTTTCACTTTTGGCTCTTGAGCACAGCATTAGCTGGAAAGCCTCTG
GTCTCGTGCAGTCAATTGTGGTGAGCAGATGTGCCTTATCACAATGACCATGGGGAGTCTGGAGGACAATTTAGTCCCCC
ACCCCACGCCCAGAAGGGAGTCTGAAAGACTCTGCTCCTTTTGGAAATGGCAAAACACAGTATTGGCGAGAGCTGATCAA
GTCTTGCTATAACCTGATTTCTGCACTGGTGGCAGGGGCACACTGTCTGTATAACCTGGTTTCTATGCCAGTGGCAAGGG
CAAACTGTCTGTGTATTGATTGTCTTTCTCTGTGTTAGTTGATGTTGGTTATCTCGTTCTGTGTTCTTGAATTTGGACTG
ATCATATTTTTGGACATGGGACAGACTGAATCTACTCTGTTAAACATCCTAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39064082..39064538 457
NO GENE  


Sequence tag IST10403H8BBF1
Sequence
GTATGTTTGTCTGTGTTTGTCACTCTATCTTTTACTTTCACTTTTGGCTCTTGAGCACAGCATTANCTGGAAAGCCTCTG
GTCTCGTGCAGTCAATTGTGGTGAGCAGATGTGCCTTATCACAATGACCATGGGGAGTCTGGANGACAATTTANTCCCCC
ACCCCACGCCCANAANGGAGTCTGAAAGACTCTGCTCCTTTTGGAAATGGCAAAACACAGTATTGGCNANAGCTGATCNN
NTCTTGCTATANCCTGATTTCTGCACTGGTGGCANGGGCACACTGNCTGTATAACCTGGTTTCTATGCCAGTGGCAAGGG
CAAACTGTCTGTGTATTGATTGNCTTTCTCTGTGTTANTTGATGTTGGTTATCTCGTTCTGTGTTCTTGAATTTGGACTG
ATCATATTTTTGGACATGGGACAGACTGAATCTACTCTGTTAAACNTNCTANTTAACCACTGAANGGNANTNANGGAAAG
ANGANAAAACTTGTCAGTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10403H8HMR1
Sequence
ATACTAGTAGGAGCCTGTTGCTGAACTCGGTCGTTTCCCCTTTGATCAGTCTATTTGGTCGTTGCTCAGGAGTCTCCTCN
AATTTGGGATGAAGCCCCCAAATGTAAGACCCTGATCCTT
Sequence Type genomic DNA
Unitrap ID UNI28081

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39064535..39064654 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]

 
Come back to gene ENSMUSG00000037386


For any suggestions or comments, please send an email to unitrap@crg.es