Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12455E12
Clone ID IST12455E12
Vector VICTR76
Project tigm

Sequence tag IST12455E12HMR1
Sequence
ATCNCTGAGCCNCATCTTGCACATTAACTACATGCAGACCGTTAATCCTTCACAGACACCCTTACCTAAATCTGAGCAGC
CCACATCTCAGCAACCCTGTGCTTCTTGTACAGACAGCTGGAATACAAGGCCTTTGACTTTGTCCTTAATATTACTTGCT
GTATTTCTCATCAAGAATGAAAGGTTGGAACC
Sequence Type genomic DNA
Unitrap ID UNI6870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29202973..29203163 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037513 (Samd4b) NM_175021 sterile alpha motif domain containing 4B Gene [Source:MGI Symbol;Acc:MGI:2448542]

 
Come back to gene ENSMUSG00000037513


For any suggestions or comments, please send an email to unitrap@crg.es