Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14936A9
Clone ID IST14936A9
Vector VICTR76
Project tigm

Sequence tag IST14936A9HMF1
Sequence
TTAGTTTTCACTAGTTTGAAATGTGGCATCACAATGTTTCTTATTTCATTTCAAAAGCAAACTCTTGACTATTGTCAAGA
AAAGCCAATGTCTACATATCTCTTCAATAAAAGAAATATGTGATATTGTACAAATTTGCTGCATTAACTATATTATACAT
TAAGAATAAATACACCAAGCTATAAAAATGTTAAATGTTTAAATACATTCTCCAAATCAAAAATGAAAGTGTTACCATCT
AACTTACTTAATGCANAGAAAATACAGATGAATCAGTTATTTAAGGCTATTACATGTGTGTCCAATTGTAATTTATCATC
NNTATTTAAATAANAACAAAACANTCTGTTTCTTAAATTCNTTTTTACTTTTNCANGCNNNANGACTCACANGCNNANNA
CTTTCNNACCNTCCNAATANAGCCACTTTCTGCATTTTTACAGTGTNCTATNNNACCACATNTGCTTCCNNTCNNAACAA
CTCNTGCTACNNAAAGCTTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14936A9BBF1
Sequence
TTAGTTTTCACTAGTTTGAAATGTGGCATCACAATGTTTCTTATTTCATTTCAAAAGCAAACTCTTGACTATTGTCAAGA
AAAGCCAATGTCTACATATCTCTTCAATAAAAGAAATATGTGATATTGTACAAATTTGCTGCATTAACTATATTATACAT
TAAGAATAAATACACCAAGCTATAAAAATGTTAAATGTTTAAATACATTCTCCAAATCAAAAATGAAAGTGTTACCATCT
AACTTACTTAATGCANAGAAAATACAGATGAATCAGTTATTTAAGGCTATTACATGTGTGTCCAATTGTAATTTANCATC
ANTATTTAAATNNNANCAAAACANTCTGTTTCTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98297347..98297701 339
NO GENE  


Sequence tag IST14936A9HMR1
Sequence
CTAAAACAAGAAAANGACTGCNNNNGTTTCCTACGTGATATATATTTCACATTGCTGAGAGCAAAACTCCTGATTTCACA
GACATAGACTGGGCACAAGACGAGCTTATCATGAACTCCTTTGTTGCAGGGTATTTGATCACACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98297203..98297350 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]

 
Come back to gene ENSMUSG00000074887


For any suggestions or comments, please send an email to unitrap@crg.es