Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST428142
Clone ID OST428142
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST428142
Sequence
CAATTCCAAAAGAATTTCCATCTTTCTAAGCATGCAAGATGAAGTTGAGACGGAAGTAATCATCAAGGACATTTTCAAAC
AAGGCAAAATCTGCTTCATCCCTCTGGTACCAATTCCAGAGCAATCACATGGACATGGNGAGGNTAACGNCACCTGAAGA
AATTGCTTTACTTCCCAAGACATCTTGGAATATTCATCANCCTGGTGAGGGAGATGTTCGGGAGGAGGCCTTATCCACTG
GTGGACTTGACCTCATCTTCCTTCCTGGCCTCGGGTTTGACAAAGATGGCAACCGGNTGGGGCGGGGTAAGGGGTACTAT
GACACCTACCTGAAGCGCTGTGTACAGCATCAGGAAGTGAAGCCCTACACCATGGCTTTGGCTTTTAAAGAGCAGATCTG
TCCCCAGATCCCAGTGGATGAGCATGACATGAAGGTAGATGAAGTCCTTTATGAAGATTCCCCAGCATCCTAAGTTACAC
CACGACGGCTACACTTACTGCTCTGTCCCGGTGTAAAGA
Sequence Type mRNA
Unitrap ID UNI18185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 89110071..89134958 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066442 (Mthfs) NM_026829 5, 10-methenyltetrahydrofolate synthetase Gene [Source:MGI (curated);Acc:Mthfs-001]

 
Come back to gene ENSMUSG00000066442


For any suggestions or comments, please send an email to unitrap@crg.es