Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12989F10
Clone ID IST12989F10
Vector VICTR76
Project tigm

Sequence tag IST12989F10HMF1
Sequence
GGGCTGGCTCACAGGTTCANAGGTTCAGTCCATTATCATCAAGGCAGGAGCATGGCAGCATCGTGGTGCAGGAGGAGCTG
ANAGTTCATCTTCATCTGAAGGCTGCTAGAANACTGACTTCCAGACAGCTAGGACAATGGTATTAAAGACCACGCCCACA
GTGACATACTTTTTCCAACAAGGCCNCACCTCCTAATAGTGCCACTCTCTGGCCCAAGCCTGTACATGACATGTGAATTC
TAAACAGCATTATTCCTTGGTATAAAGTCNAGCTGGTTATGAGGANTACAAGGTTATAAAAAGCCNNTGGTGACTCTTGA
ACAGTCNACG
Sequence Type genomic DNA
Unitrap ID UNI32403

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103056930..103057258 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032549 (Rab6b) NM_173781 RAB6B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:107283]

 
Come back to gene ENSMUSG00000032549


For any suggestions or comments, please send an email to unitrap@crg.es